vectorstrip

vectorstrip

vectorstrip is useful for stripping vector sequence from the ends of sequences of interest.

Here are several examples of running vectorstrip. The vectorfile and the sequence files used in these example are given below. In each case, the same fragment has been cloned into the XhoI site of the polylinker of each vector. The cloned fragment is represented in lowercase, and the vector sequence is represented in uppercase. This makes it easy to see the sequence trimming.

  1. Running vectorstrip on a list of sequences with default parameters:

    % vectorstrip @seqs.list Strips out DNA between a pair of vector sequences Are your vector sequences in a file? [Y]: Name of vectorfile: vectors Max allowed % mismatch [10]: Show only the best hits (minimise mismatches)? [Y]: Output file [pbluescript.vectorstrip]:stdout Output sequence [pbluescript.fasta]:     Sequence: pBlueScript    Vector: pTYB1  No match     Sequence: pBlueScript    Vector: pBS_KS+ 5' sequence matches:         From 67 to 83 with 0 mismatches 3' sequence matches:         From 205 to 219 with 0 mismatches Sequences output to file:         from 84 to 204                 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                 cacagtgacatgagagacacagatatagagacagatagacgatagacaga                 cagcatatatagacagatagc         sequence trimmed from 5' end:                 GGAAACAGCTAATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT                 AAAGGGAACAAAAGCTGGGTACCGGGCCCCCCC         sequence trimmed from 3' end:                 TCGAGGTCGACGGTATCGATAAGCTTGATATCG     Sequence: pBlueScript    Vector: pLITMUS        No match     Sequence: litmus.seq     Vector: pTYB1  No match     Sequence: litmus.seq     Vector: pBS_KS+        No match     Sequence: litmus.seq     Vector: pLITMUS 5' sequence matches:         From 43 to 61 with 0 mismatches 3' sequence matches:         From 183 to 199 with 0 mismatches Sequences output to file:         from 62 to 182                 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                 cacagtgacatgagagacacagatatagagacagatagacgatagacaga                 cagcatatatagacagatagc         sequence trimmed from 5' end:                 TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT                 GCAGGAATTCC     Sequence: pTYB1.seq      Vector: pTYB1 5' sequence matches:         From 40 to 58 with 0 mismatches 3' sequence matches:         From 180 to 196 with 0 mismatches Sequences output to file:         from 59 to 179                 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                 cacagtgacatgagagacacagatatagagacagatagacgatagacaga                 cagcatatatagacagatagc         sequence trimmed from 5' end:                 CTTTAAGAAGGAGATATACATATGGCTAGCTCGCGAGTCGACGGCGGCCG                 CGAATTCC         sequence trimmed from 3' end:                 TCGAGGGCTCTTCCTGCTTTGCCAAGGGTACCAATGTTTTAATGGCGGAT     Sequence: pTYB1.seq      Vector: pBS_KS+        No match     Sequence: pTYB1.seq      Vector: pLITMUS        No match     % more pbluescript.fasta >pBlueScript_from_84_to_204 KS+ tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >litmus.seq_from_62_to_182 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c >pTYB1.seq_from_59_to_179 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagcacacagtgaca tgagagacacagatatagagacagatagacgatagacagacagcatatatagacagatag c
  2. Running vectorstrip allowing maximum 30 percent mismatch, then asking only for best hits:

    % vectorstrip litmus.seq Strips out DNA between a pair of vector sequences Are your vector sequences in a file? [Y]: Name of vectorfile: vectors Max allowed % mismatch [10]: 30 Show only the best hits (minimise mismatches)? [Y]: Output file [litmus.vectorstrip]: stdout Output sequence [litmus.fasta]:     Sequence: litmus.seq     Vector: pTYB1  No match     Sequence: litmus.seq     Vector: pBS_KS+        No match     Sequence: litmus.seq     Vector: pLITMUS 5' sequence matches:         From 43 to 61 with 0 mismatches 3' sequence matches:         From 183 to 199 with 0 mismatches Sequences output to file:         from 62 to 182                 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                 cacagtgacatgagagacacagatatagagacagatagacgatagacaga                 cagcatatatagacagatagc         sequence trimmed from 5' end:                 TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT                 GCAGGAATTCC         sequence trimmed from 3' end:                 TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG                 GCCTTAAGTGAGTCGTATTACGGA
  3. Running vectorstrip allowing maximum 30 percent mismatch, then asking for all hits:

    % vectorstrip litmus.seq Strips out DNA between a pair of vector sequences Are your vector sequences in a file? [Y]: Name of vectorfile: vectors Max allowed % mismatch [10]: 30 Show only the best hits (minimise mismatches)? [Y]: N Output file [litmus.vectorstrip]: stdout Output sequence [litmus.fasta]:     Sequence: litmus.seq     Vector: pTYB1  No match     Sequence: litmus.seq     Vector: pBS_KS+        No match     Sequence: litmus.seq     Vector: pLITMUS 5' sequence matches:         From 43 to 61 with 0 mismatches 3' sequence matches:         From 183 to 199 with 0 mismatches         From 228 to 244 with 5 mismatches Sequences output to file:         from 62 to 182                 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                 cacagtgacatgagagacacagatatagagacagatagacgatagacaga                 cagcatatatagacagatagc         sequence trimmed from 5' end:                 TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT                 GCAGGAATTCC         sequence trimmed from 3' end:                 TCGAGACCGTACGTGCGCGCGAATGCATCCAGATCTTCCCTCTAGTCAAG                 GCCTTAAGTGAGTCGTATTACGGA             from 62 to 227                 tcgagagccgtattgcgatatagcgcacatgcgttggacacagatgagca                 cacagtgacatgagagacacagatatagagacagatagacgatagacaga                 cagcatatatagacagatagcTCGAGACCGTACGTGCGCGCGAATGCATC                 CAGATCTTCCCTCTAG         sequence trimmed from 5' end:                 TCTAGAACCGGTGACGTCTCCCATGGTGAAGCTTGGATCCACGATATCCT                 GCAGGAATTCC         sequence trimmed from 3' end:                 TCAAGGCCTTAAGTGAGTCGTATTACGGA
  4. Running vectorstrip against a sequence containing Ns:

    % vectorstrip pTYB1_N.seq Strips out DNA between a pair of vector sequences Are your vector sequences in a file? [Y]: Name of vectorfile: vectors Max allowed % mismatch [10]: 30 Show only the best hits (minimise mismatches)? [Y]: Output file [ptyb1.vectorstrip]: stdout Output sequence [ptyb1.fasta]:     Sequence: pTYB1.seq      Vector: pTYB1 5' sequence matches:         From 40 to 58 with 2 mismatches 3' sequence matches:         From 180 to 196 with 2 mismatches Sequences output to file:         from 59 to 179                 tcnagagccgtatngcgatatngcgcacatgcgntggacacagangagca                 cacagtnacatgagagncacagatntagagacagatngacgataganaga                 cagcatanatagacanatagc         sequence trimmed from 5' end:                 CTTTAAGNAGGAGANATACANATGGCNAGCTCGCGANTCGACGGCGGNCG                 CGAATNCC         sequence trimmed from 3' end:                 TCGNGGGCTCTTCCNGCTTTGCCANGGGTACCAANGTTTTAATGGCNGAT     Sequence: pTYB1.seq      Vector: pBS_KS+        No match     Sequence: pTYB1.seq      Vector: pLITMUS        No match

Mandatory qualifiers (bold if not always prompted):

[-sequence] (seqall)

Sequence database USA.

[-[no]vectorfile] (boolean)

Are your vector sequences in a file?

* [-vectors] (infile)

Name of vectorfile.

-mismatch (integer)

Max allowed percentage mismatch.

-[no]besthits (boolean)

Show only the best hits (minimize mismatches)?

-linkera (string)

5' sequence.

-linkerb (string)

3' sequence.

[-outf] (outfile)

Output filename.

[-outseq] (seqoutall)

Output sequence(s) USA .



Sequence Analysis in a Nutshell
Sequence Analysis in a Nutshell: A Guide to Common Tools and Databases
ISBN: 059600494X
EAN: 2147483647
Year: 2005
Pages: 312

Similar book on Amazon

flylib.com © 2008-2017.
If you may any questions please contact us: flylib@qtcs.net