primersearch

primersearch

---

primersearch reads in primer pairs from an input file and searches them against sequence(s) specified by the user. Each of the primers in a pair is searched against the sequence, and potential amplimers are reported.

Here is a sample session with primersearch:

% primersearch embl:Z52466 Searches DNA sequences for matches with primer pairs Primer file: primers Output file [hsa203yc1.primersearch]: stdout Allowed percent mismatch [0]:      Primer name D1S243     Primer name D1S468     Primer name D1S2845     Primer name D1S1608     Primer name D1S2893     Primer name D1S2660 Amplimer 1         Sequence: HSA203YC1 Z52466          H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.         CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches         AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches         Amplimer length: 261 bp

Here we run the same example, but allow a 20% mismatch between the primers and the sequence:

unix % primersearch embl:Z52466 Searches DNA sequences for matches with primer pairs Primer file: primers Output file [hsa203yc1.primersearch]: stdout Allowed percent mismatch [0]: 20     Primer name D1S243     Primer name D1S468     Primer name D1S2845     Primer name D1S1608     Primer name D1S2893     Primer name D1S2660 Amplimer 1         Sequence: HSA203YC1 Z52466          H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.         CACACATGCACATGCAC hits forward strand at 49 with 2 mismatches         AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches         Amplimer length: 239 bp Amplimer 2         Sequence: HSA203YC1 Z52466          H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.         CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches         AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches         Amplimer length: 261 bp

Here is an example of running with a file containing a list of sequences.

% primersearch @seqs.list Searches DNA sequences for matches with primer pairs Primer file: primers Output file [hs214yg7.primersearch]: stdout Allowed percent mismatch [0]:      Primer name D1S243 Amplimer 1         Sequence: HS214YG7 Z16979          H. sapiens (D1S243) DNA segment containing (CA) repeat; clone AFM214yg7; single read.         CACACAGGCTCACATGCC hits forward strand at 122 with 0 mismatches         GCTCCAGCGTCATGGACT hits reverse strand at [36] with 0 mismatches         Amplimer length: 162 bp     Primer name D1S468 Amplimer 1         Sequence: HS280WE5 Z23994          H. sapiens (D1S468) DNA segment containing (CA) repeat; clone AFM280we5; single read.         AATTAACCGTTTTGGTCCT hits forward strand at 47 with 0 mismatches         GCGACACACACTTCCC hits reverse strand at [96] with 0 mismatches         Amplimer length: 185 bp     Primer name D1S2845 Amplimer 1         Sequence: HS344WE9 Z51474          H.sapiens (D1S2845) DNA segment containing (CA) repeat; clone AFM344we9; single read.         CCAAAGGGTGCTTCTC hits forward strand at 29 with 0 mismatches         GTGGCATTCCAACCTC hits reverse strand at [157] with 0 mismatches         Amplimer length: 201 bp     Primer name D1S1608 Amplimer 1         Sequence: HS829186 G07829          human STS CHLC.GATA49A06.P15262 clone GATA49A06, sequence tagged site.         GATGGCTTTTGGGGACTATT hits forward strand at 13 with 0 mismatches         CACTGAGCCAAGTGACACAG hits reverse strand at [92] with 0 mismatches         Amplimer length: 270 bp     Primer name D1S2893 Amplimer 1         Sequence: HS123XC3 Z50993          H.sapiens (D1S2893) DNA segment containing (CA) repeat; clone AFM123xc3; single read.         AAAACATCAACTCTCCCCTG hits forward strand at 5 with 0 mismatches         CTCAAACCCCAATAAGCCTT hits reverse strand at [3] with 0 mismatches         Amplimer length: 215 bp     Primer name D1S2660 Amplimer 1         Sequence: HSA203YC1 Z52466          H.sapiens (D1S2660) DNA segment containing (CA) repeat; clone AFMa203yc1; single read.         CACACATGCACATGCAC hits forward strand at 27 with 0 mismatches         AGTGACACCAGCAGGG hits reverse strand at [103] with 0 mismatches         Amplimer length: 261 bp

Mandatory qualifiers:

[-sequences] (seqall)

Sequence database USA.

[-primers] (infile)

Primer file.

[-mismatchpercent] (integer)

Allowed percent mismatch.

[-out] (outfile)

Output filename .